CShisMan2_1745


Sequence

>CShisMan2_1745 (4 EST) Length=251 AAACCAGCTAAACTTTACACATCTAGTAAATTATAGTACNCTCACTACTCTCTTCTATATACCAAGTAGTATCACTACCA ACATTAAAATTCTCAAAACCAACACTACCAAACCTATGTATCAACCCAATACTAATCTCCTTAACAATCGATACAAGTAA TTAAATAAAGCTANCTCTCAACGAAATACTACAAAACTAATCAAATCTGAAAAGTATACATCAACCCTTTAAATAAACCC CTAAGNTATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1745: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
60720529750T24147SMEST0345Schistosoma mansoni, adult worm, Gloria Franco
345018981285R95625SMNHADA019025SKSmAW
4236411139742N25394EST00068S. mansoni cDNA
9102431906707AA269240MA1AS009.AASS. mansoni adult Lambda Zap


Date: 20:13:24 on Sat 18 Nov 117.