CShisMan2_1755


Sequence

>CShisMan2_1755 (2 EST) Length=289 ATATTATACTAACGAATTTATTTCTGCGGCAGTTCGTTAGATACTAATTTGTTCTAAAATAGTTTTACACTTCTCATTTA AGCNCACTGAATATTGTCTTGGCAACCTGATGATCTACGCACCCTAGTAAATCTACTAATTCTTCTTCACAACTTTCCTT TGTTCTGCTTTGTCTGTCTCCACATTCTTCCAATCTCGTTTGAGAAAAGGACAGCAGTGGTGAGAAACTCTGGCTTCTTT GCGAAGCGTATCCAAAGGATCAAACAGCCTCTTCGTCAGACATCGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1755: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900202956644AA864165SMTBCEA000028SKSchistosoma Lambda Zap II cercariae
17369173189837AA999282MCCE3091.M1FSchistosoma mansoni, cercariae


Date: 15:33:24 on Fri 24 Nov 117.