CShisMan2_1763


Sequence

>CShisMan2_1763 (2 EST) Length=250 AAAGCATATTCAATTAATTAAGAATACACTTAAAAAAGATGTGAAATTACATGAATTTTGTCTTGATCCAAGTTTACAAA GAGCAACTAAAATTAATGGAATTGGTCAAGCATTAGACAAATTAAAAGTGAATGAAGCTACGAAAAATCTATTTGTTATA CTTGCTGAAAACGGTCGTTTGTCTAAAATTAATTCAGTTATTGACAAATTTGAACAAATTATGACTGCCTATCGAGGTGA AGTTAACTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1763: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12100522330341AA559645MC240701.NA3TBRI-Saber-cercaria-A
16099902992139AA883028SMTBCEA000057SKSchistosoma Lambda Zap II cercariae


Date: 8:50:55 on Mon 20 Nov 117.