CShisMan2_179


Sequence

>CShisMan2_179 (2 EST) Length=564 GGAGAACTTTCCCCATATAATCAGTGATATATTATCCGAAGTCGTTCGGGATGGTTTTCCAGTGGAATCTGTTGAGGCTA CTCTTCATCAGTACGAACTAGAAATTCGACATGAGTCTGCTCGCTTTGGTTTAAATCTAATCCTGAACCTATCCAATGCT GTTAATCATGGTGTTGATTTAAACGAGTTCCTGAAAATTGGAGCTAATGTGGATCGATTTCGGCAGGAATGGAACACGGA TCCGACTATACTTCAAAGTTTTGTTCAGCAATTCTTTCTAGATAACAAACATAAACTGATAACTGTAATGCGTCCTGATC CAAACTGGAGGTCCATAGAAGCCAAGAAGGATGAAGAAAATTTGGATAGTTTGACAAAGGACATAACACCGTTGGAAAGG GAAAAATTAGCACTAAAGGCTCATCAACTCCTTGAAAAACATAGATCAAGAAGAAGATGTTTCATGTTTACCGTGCCTCG ACATTTTTGACGTACCTTTGGAATGCCGACCAGAAACGTTTACACTCACTCAAACTTCTGAATTTCCTGTCCAGTTGAGC GAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_179: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18155773385937AI067970EST209659Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156103385970AI068003EST209692Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:34:47 on Thu 23 Nov 117.