CShisMan2_1794


Sequence

>CShisMan2_1794 (2 EST) Length=245 GTGATGTTAAGTGTATATTGGACTACAACATTAATGAATTTCGAACATAAATATTTTAGTGTTTTAATGATTAAAGTCAT ATGTACGTTAATAAAAAAATTTGCACGCCACACCAGTAAGGAAATCCCTGAAAAAATACCAGGATGGTTAGTCCTCATCT GAAGAGGAGGACTCCGAAGGCTTGGCATTTCCTGGACGGTGAATTACAGCTGATGTTATTCGGGGCCCCTTTGAACTAAC GTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1794: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5137441444997W06777SMEST0413Schistosoma mansoni, adult worm, Gloria Franco
17654263241833AI026219MEEG0456.M1FSchistosoma mansoni, egg stage


Date: 5:56:17 on Sun 19 Nov 117.