CShisMan2_1795


Sequence

>CShisMan2_1795 (2 EST) Length=362 ACCATATCAATATTTTTTTCCCAATTAAAACCTTTAATTNCCTATTTCACAACTCCTTTTCCCCCCTTTCATTTTCCCTT TAACCATATTCAAAATCCACCGTATTATCCCTAATCTAATTAACAAAAATACTAAGTTATAACAAAGGTTATCCCTTCAT ATAATTAACCCTTAATNGTTAAATGACATGATTAAATCCCTAATAAACATTTCACATACTTCCACTGCTAAATAATAATA ACAACTACATCGCTTTTTTCCTTAATTTTACACTTATATAATATCTGTNCAAAAAGCTAAAGGTAGTAAAGGGTTAATTN GTAAATTGTTAATAACGGTTAGCAGATTACATGAGCTTACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1795: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368953189815AA999260MCCE3057.M1FSchistosoma mansoni, cercariae
17372513190171AA999616MCCE3589.M1FSchistosoma mansoni, cercariae


Date: 23:34:32 on Fri 17 Nov 117.