CShisMan2_1808


Sequence

>CShisMan2_1808 (2 EST) Length=265 ATTAATTGAATATTCACTATGGAAGAATTGGACGTCAAAGAGATGTTCTGTATGATTGNATAAGNAAACAACGTGGGTAG NAATCACTTGTAAACAATTAAGATCATTTCTAAGNAAAACATGACGCTAAATTCAGTAGGAGATCTGTAAGNAAATTACG TCAAGTCAATAGACAGTGATGGGGATGGTAAATTAACATTGGATGACTTAATAAGAGCGCTTACCAAATGTGATCATTCA AAATAAATTATGTTAACTGTGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1808: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4191501128001N21868SMNHADA019013SKSmAW
11587272252904AA514100MA2MA112.AA3S. mansoni adult Lambda Zap


Date: 6:41:12 on Sat 25 Nov 117.