CShisMan2_1819


Sequence

>CShisMan2_1819 (2 EST) Length=245 GAGAACAGCGATCCACGGCTTGCCCGTTTAATCAGTCTAGCTGGTCAAAAATTTCTGACTGATATCCTTTCTGACGCTAT GCTTCATTGGCGCCTTGCAAATGGACAGCCTACTGGGGTTGCTTAACCATTCTAGTGTGTCTACATCTATACCAGGTCAA GCATCTAATCCGTCTTATATGAATGCTACTACAACACCAGCAAGGCAACCCAAGGTCAGTCTATTTCCACAGGTCTCCAT CATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_1819: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344409972810L46942SCMRAP029C2/C2 adult worm mini-library
344417972818L46950SCMRAP037C2/C2 adult worm mini-library


Date: 16:28:49 on Sat 18 Nov 117.