CShisMan2_182


Sequence

>CShisMan2_182 (6 EST) Length=562 GCACGAGGTTTAAAGAAGGTTTTATTAGTAATCATTAACCCATAGGAAATATTATAAATTGATTTTGCAATGTAGAAAGA ATCCAATGACACTTATATACATAAGAAAAGAAAACGAAGTTAGAAGTGCATTCATTTCATACAAACATCTGTAAAATAAA AAGAACTAGGCCCAATTTGGACTAGGTAATAATTATAGATTATTAAAACATTATTACTGAACTAAGAGAGTGTAAGACGA AAAGAAGAGAGGAAATTTTCTAGTGGAAAAAAAACAGAAACAAAATAGAACTATTCAACTGTTTCTTTTTTTTTTGCAAA AAGCATAATTAATACAAACTAGGCTGTTCATTTCGTAGTTCATTTTTATTGTTTTGACAATGTTCTTGAAGAAGTTGTAA TATATCTGTTTGAAAATATTCCGGGGCTTCTTTTGCCTTTGTAATCCAATAGTAAATGTCCTCATGCAGTGTCTGGTAAG TTGATTAAACTATCATACGCAATAAGTTGTTCATGAGTCATTGAATTCAGGTATTTAGCAGCAAATGTACTTAACAGAAT TC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_182: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165692338818AA566186MA3MR058.AA3S. mansoni adult Lambda Zap
13277852552122AA629511MU000126.Y2RSmL
17371563190076AA999521MCCE3431.M1FSchistosoma mansoni, cercariae
18149043385264AI067297EST208975Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157333386093AI068126EST209816Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158643386224AI068257EST209948Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 22:11:35 on Fri 17 Nov 117.