CShisMan2_1821


Sequence

>CShisMan2_1821 (20 EST) Length=254 ACGCGAATTTACAAATATTAACGCTACATTGCATTCGCATTCAGCTCGCAACTGTTCGAAGGCGACTGTGGCTCTTGCTA TTAGNCTTAAGCTGGCAAAGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTG TAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTA TCGATAAGCTAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1821: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236221139723N25375EST000516S. mansoni cDNA
4236341139735N25387EST000542S. mansoni cDNA
4236401139741N25393EST000066S. mansoni cDNA
4291641145890N28034EST000119S. mansoni cDNA
4291651145891N28035EST000123S. mansoni cDNA
4291701145896N28040EST000177S. mansoni cDNA
4291731145899N28043EST000247S. mansoni cDNA
4291791145905N28049EST000286S. mansoni cDNA
7364611644597AA098627SMTBADAMS0626SKS. mansoni cDNA
14960572833718AA774382SMTBADA000717SKSchistosoma Lambda Zap II
15233802870782AA801610SMTBADA000770SKSchistosoma Lambda Zap II
15233832870785AA801613SMTBADA000775SKSchistosoma Lambda Zap II
15233882870790AA801618SMTBADA000848SKSchistosoma Lambda Zap II
15259422873399AA804151SMTBADA000929SKSchistosoma Lambda Zap II
15469592897580AA825102SMTBSOA000005SKSchistosoma Lambda Zap II
15469602897581AA825103SMTBSOA000006SKSchistosoma Lambda Zap II
15469662897587AA825109SMTBSOA000012SKSchistosoma Lambda Zap II
15900022956626AA864147SMTBSOA000024SKSchistosoma Lambda Zap II
15900132956637AA864158SMTBSOA000058SKSchistosoma Lambda Zap II
16890873116456AA952864SMTBADA000626SKSchistosoma Lambda Zap II


Date: 20:48:25 on Thu 23 Nov 117.