CShisMan2_1829


Sequence

>CShisMan2_1829 (3 EST) Length=375 CAAAAAATAATTGAATCGTCCTGTTAAAAGCACAATCAGAAGTTTACTAACTTCATATTGATTAAGGTGTACAAAGTTTA TTGAAAGAGATGAAACACAAAGTCGAAAATTACTCACATAATATAAACTCCACTGTATATAAAAATAATGAGTAAATATT TTCCGGCTAAGTGTGAAAAATTAGGGTTTTTCGCTTAATTTTTTAATGGTTGTTTTCTGTTTATTTTTTCACTAAGCGTT TTCGTAATGTCACTTACTAATTAACTAGCTCACCGAGCACATTTAATAGCCAATAGAACAATATACTGCAAATACTAGAC AAATCATTTGGACCAATGCGAACAGAAACAACGCTAACTATGATAGACATTGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1829: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350248988879H49038EST000175S. mansoni cDNA
5137711445024W06804SMEST0440Schistosoma mansoni, adult worm, Gloria Franco
7824151713253AA143848MCCE0222.M1FSchistosoma mansoni, cercariae


Date: 10:30:31 on Tue 21 Nov 117.