CShisMan2_183


Sequence

>CShisMan2_183 (6 EST) Length=621 ACGACGCAGCAAGATCATGTGTTTTTCAAGCTAGTAATGAATGGTTTGACTGTACTGCTTCAGGATCCCTTCGGTGAATC TGATGGATTTTCTCGTTTTTGTCCTTGTCGTGATGCTCTTCCTAACCAGATTTCTTTATGTTCTAACTGTTTGTGACAAA ATATTCTATTCCTTAATGATAACATGTGTAGGAAATTATAAAAGCTACATTCATACTTTCACCTTTCCGTACGGTTGTAT ATAAATCGTATTATGTACTTTCTTTAACATTTTAAGTGTACGGTGAATTACTGAATATTTAATTGTTATTTTCTATCGAA AAGCATTTTACCCACTTCAGTCTATAAGATTGATTAATATATTTACTATTAACTGCATTTTAATTTTGTATTTACTTCCT ATAAATTCTAGTTTACAATATTTTTCTTTTCTAAAGTTTTTGTTCCTTCAGATTTTTGCTTATAAGAATTTAATTTAAAA TTTCTTTCTATATTTATTCTTATTTTCATGCTTGTACAACGTATTTTCGAAAGGTATGAAAATAATATTATTGTGTGTTA GGAAAAAAAAAAAAAAAAAAAAAAAAAAAACCATGCAGCTGCATTACCGTACTGCGTAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_183: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148443385204AI067237EST208911Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148463385206AI067239EST208913Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149313385291AI067324EST209002Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150413385401AI067434EST209116Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152773385637AI067670EST209353Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155763385936AI067969EST209658Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:16:24 on Fri 17 Nov 117.