CShisMan2_1833


Sequence

>CShisMan2_1833 (2 EST) Length=240 ATAATCTTATCATTGGGTTGTTTCTTTCTGGTTCACCATATTTTTGTACATTCATTATCTGACGTCAGTTCAAAATGTCG ATGTAAATGGTTCTCATCCATCTGTATCATTATTATCAGCTTCCAACTTATNCTCACCTAAAAATGAGCCGAGTGCAAAT CAAACCACACAGGCTAAATGGCAGTATTTATGTTCATATATGAAGTACAAATGTAGTGAGTTACCAGGTTATTGTCTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1833: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100601906125AA269093MA1MA034.AA3S. mansoni adult Lambda Zap
9100661906131AA269034MA1MA034.AA3S. mansoni adult Lambda Zap


Date: 7:32:21 on Sun 19 Nov 117.