CShisMan2_1847


Sequence

>CShisMan2_1847 (2 EST) Length=248 GATACATGTATACATAATTTGTNTTTTTCTTGTGTTCCCTTTCANCATGTTCGGTGCCTTATTGTCCATGTTGTTTGCTT TTGTTTTTTCTTTANCCTGAAATTAAGGATTACCACCATGCTCTATGTTTAAATGCTATTATATATGCATCTGTGTACAC ATTCGTGTNAATTGCGCAAATGNATCCACATAACCCGCATTGGGNAATCTCTTCACTCATCTCTCTCATTTTTTNTAATA TTCTAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1847: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344405972806L46938SCMRAP025C2/C2 adult worm mini-library
344411972812L46944SCMRAP031C2/C2 adult worm mini-library


Date: 2:30:4 on Mon 20 Nov 117.