CShisMan2_185


Sequence

>CShisMan2_185 (10 EST) Length=657 AATAAGACAAATGATTTACGGCTACCAATTAGGAAATGCACAATTTCTGTGAGCGTATTTGTGTAAAAGTGCTTATGTGC TTTCACACATTAACATGGTTAAACTAGGTTTAATTACTTTTCACCCCCATTGGTTAACACATTGGACTAAAAATATCTTT GTTTCTCTACATTANGTATATATATACTGCTTACAAATTCGGCTAATAATGATAATCCATTAGTTGATTTTCATAAATAT CATGTAAATGGTTGTTATTGTTAGAGAAAAAATAGGTGACGATGATAATGATGATTTCAATAATTGTGGAGCAGAATTAC AATTATCTGTACCACAAATGCATAATTCTGAATAGCCACCTTCTGAAGCACGATTGACACATCTAATNTNTTCTGGCTCA GCACCTTCAGTAGCACAGAAACGTTTCATCAATGTGACTTCTTTAACTCGACCTTTAGCAACGGGTTCTTTTAAGTAGGT GGTAAGTTTAGCACATCCACGTGGTGTATTCTTAGCATTCACAATACATGGTTTATAGAATAGTTCTGGTTCATCTAAAC ATCTACGACGATACATATCAGTTTCTACAAAACTTTTCGATTTATCCACTTCTAATTTCATTTCACATTGTGCCTCGTGC CGNNTCCTGCAGCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_185: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190061126893N21723SMNHADA00E026SKSmAW
4291971145923N28067EST000026S. mansoni cDNA
18694403509841AI111153MF003F04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694423509843AI111155MF003F02.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694473509848AI111160MF003E09.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694713509872AI110902MF003C08.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694813509882AI110912MF003B09.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695033509904AI110934MF002H10.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695373509938AI110968MF002F01.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696523510053AI111083MF001C04.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 18:39:50 on Sat 18 Nov 117.