CShisMan2_1855


Sequence

>CShisMan2_1855 (55 EST) Length=707 CCCCCGGGCTGAAGGAATCCGGCACTCGACGANNGTTTTTCTTTAGTAAATTTAGTATTGTTTTTTGCGGTGCTTCCTTG CATATTTTTTTATCATCCGTTTATTATGACATTTGTTTTGTGTATATGAGTTTACTTGTTTCGCAAGTATGTAGTTTGAG ATATATCTACGTTACGGATTAGTTGTAAGATGGCGTTTTGGTTGTTTTTAGTTAGGGAGTTAATTGTTTTTCTTACTATA ATTTTTTGTTGTTTTTGGTATATTAAGGATTCTAGCATTGCAATTTCTTATCCATTAGGTATTCCTCTTTTAGAAACTTA CTTGTTGATAATGTCTTCTTTTTTTATTTCTGCTTTTCATAGGAATTTGGCTAGTGTAAAAAGTCGTATTTTTGTTTATT TATCACTTATTTGTTCCTTATTATTTGTTTTTTTTGCTGTGGATGAATTTTTGAATAGTGTAGTTAATTCTTTATGTGAT CCATATTATGCGAGTTGTTTTATGTTGGTTGGCTTACATCTCAGGCATGTTATTTTAGGTAGGTTTGGTTTATATGAGTT ATTAGGTTTTCGGTTGTCTAGATTTATTCGTTGGAAGAGTAAAGTGTTAATAGTGTATTGACATTTTGTTGATTATATAT GACTCTTGGTTTATTTAGTAGTATATATAGTTCATTTGTAGCTTAATGTATGATTTAATTNGGTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_1855: (55 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333900965459R93105EST000039S. mansoni cDNA
344657975522R95413SMNHADA009042SKSmAW
344846975902R95500EST000058S. mansoni cDNA
345019981286R95626SMNHADA019029SKSmAW
350219988850H49009EST000104S. mansoni cDNA
350224988855H49014EST000064S. mansoni cDNA
3644481017375H63029EST000297S. mansoni cDNA
4071421119148H98263SMNHADA015010T3SmAW
4071701119176H98291SMNHADA015096T3SmAW
4071721119178H98293SMNHADA016031T3SmAW
4071821119188H98303SMNHADA016051T3SmAW
4179741125863N20691SMNHADA001030SKSmAW
4179991125888N20716SMNHADA002037SKSmAW
4180281125917N20745SMNHADA007078SKSmAW
4180421125931N20759SMNHADA008020SKSmAW
4180531125942N20770SMNHADA008039SKSmAW
4180581125947N20775SMNHADA008048SKSmAW
4189831126870N21700SMNHADA009063SKSmAW
4190101126897N21727SMNHADA00E032SKSmAW
4190181126905N21735SMNHADA017010SKSmAW
4190341126921N21751SMNHADA017049SKSmAW
4190371126924N21754SMNHADA017054SKSmAW
4191461127997N21864SMNHADA019005SKSmAW
4191581128009N21876SMNHADA019024SKSmAW
4191711128022N21889SMNHADA019047SKSmAW
4191801128031N21898SMNHADA019059SKSmAW
4192101128061N21928SMNHADA020022SKSmAW
4236361139737N25389EST00052S. mansoni cDNA
4291991145925N28069EST000032S. mansoni cDNA
4350001154024N33625SMNHADA001025SKSmAW
4350561154080N33681SMNHADA017061SKSmAW
4350731154097N33698SMNHADA018094SKSmAW
7824041713242AA143837MCCE0206.M1FSchistosoma mansoni, cercariae
8248171769668AA185752MAAD0159.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248491769700AA185784MAAD0194.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248651769716AA185800MAAD0232.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248701769721AA185805MAAD0249.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8577861832546AA218453MAAD0108.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578471832607AA218514MAAD0195.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
9101831906248AA269180MA1MR003.AA3S. mansoni adult Lambda Zap
9101901906255AA269187MA1MR010.AA3S. mansoni adult Lambda Zap
11529412245776AA508336MAAD0372.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529442245779AA508339MAAD0368.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529692245804AA508288MAAD0308.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12098102330099AA559403MC250413.NA3TBRI-Saber-cercaria-A
12099032330192AA559496MC270423.NA3TBRI-Saber-cercaria-A
12101362330425AA559729MC041005.NA3TBRI-Saber-cercaria-A
12101392330428AA559732MC041008.NA3TBRI-Saber-cercaria-A
12101992330488AA559792MC250451.NA3TBRI-Saber-cercaria-A
15234022870804AA801596SMTBADA000920SKSchistosoma Lambda Zap II
15469482897569AA825091SMTBCEA000014SKSchistosoma Lambda Zap II cercariae
16629043080329AA931020SMTBADA000085SKSchistosoma Lambda Zap II
16629083080333AA931024SMTBADA000182SKSchistosoma Lambda Zap II
16629143080339AA931030SMTBADA000197SKSchistosoma Lambda Zap II
16716403098727AA938828SMTBADA000297SKSchistosoma Lambda Zap II


Date: 21:49:41 on Mon 20 Nov 117.