CShisMan2_1857


Sequence

>CShisMan2_1857 (5 EST) Length=360 TGGGAAATGTTCATCTATATATTCATTCTGTAATATGTATGAATCCATAGTCCACTGTATTGTCAATAATAAAATTATTA TTGAGATGGTGTTGCTCCATGCTAAACAGACATAATTATTATACTTAAATTGTATTGATAAAAATGGTTACATGTGNAAA TTCATCCAATATGAACCAGTTAGTAGANCTACTTTGCCATACACGACCATATGTGTTATCCAATAATGATTTCATTTTAT TTGCTACCTCTCTCATGTCATTACCTGTTCGACTAGTATTATCAACATACTCTTTAAATTGACAACATATTTCATATTGT TTTGTTTTGGACATGGTTGCTGCATAATTTCAATATTCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1857: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344916975972R95602SMNHADA017034SKSmAW
345046981313R95653SMNHADA020046SKSmAW
4291741145900N28044EST000258S. mansoni cDNA
7364601644596AA098626SMTBADAMS0625SKS. mansoni cDNA
16890863116455AA952863SMTBADA000625SKSchistosoma Lambda Zap II


Date: 2:39:9 on Wed 22 Nov 117.