CShisMan2_186


Sequence

>CShisMan2_186 (8 EST) Length=564 CACCCCGTTTTAGCAACGATTGAGTTGATGCATCTAAGTCAGAACCAAATTGAGCAAAAGCAGCTACTTCTCGATACTGA GCTAACTCTAGTTTCATGCGACCAGCAACCTGTTTCATAGCTTTAGTTTGTGCAGCAGACCCAACACGACTAACAGAAAG ACCAACATTGATAGCAGGTCTTATACTTTTATGGAATAATTCAGTCTCCAAGAAAATTTGCCCATCAGTTATAGAGATAA CGTTAGTTGGAATGTATGCAGATACATCACCGGCCTGTGTTTCAATGACTGGAAGGGCTGTTAGTGAACCGCCTCCATAG GAATCATTCATCTTAGCAGCTCTCTCCAGTAAACGGGAGTGCAAATAAAACACATCACCAGGATAAGCTTCTCTTCCTGG AGGTCTTCGTAACAGAAGTGACATTTGTCGATAGGCAACAGCCTGTTTAGATAGATCGTCATAAATTATTAATGCATGCT TCCCATTATCACGAAAATATTCGCCCATTGCACACCCTGCGTATGGAGCCAAGTACTGAAGCGGAGCTGCATCAGATCTC GTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_186: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146373384997AI067030EST208699Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147003385060AI067093EST208763Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147713385131AI067164EST208835Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149123385272AI067305EST208983Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154533385813AI067846EST209530Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155543385914AI067947EST209635Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158763386236AI068269EST209960Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159353386295AI068328EST210019Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 18:10:9 on Fri 17 Nov 117.