CShisMan2_1869


Sequence

>CShisMan2_1869 (2 EST) Length=239 TCCNTNATTGCCACCGCCGCCACCNCCGCCGAATGCTCTTCATCCGNCAACACGAGTTGATAATGCANAGGATTTTCGAC ATGCATCTAACCAAGGAAAGTGATTATTGNCCAATTAAAACCCTGACCTTAAAGGAATATTAATGATGACTACATCTGGG CCACATCCAGCCACACCACCTAAGCTCTATACAAAAGTAATTCATAGTTATTTTGCGGACCTTATAGATAACATCTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_1869: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344797974654L47057SCMRAP144C2/SK adult worm mini-library
344813974670L47073SCMRAP160C2/SK adult worm mini-library


Date: 9:28:2 on Sun 19 Nov 117.