CShisMan2_1879


Sequence

>CShisMan2_1879 (2 EST) Length=233 AAGNAATGTCCTTGNATAACTTTGACCAATATGAGTTTTACATGGGTCCGCCATCTAATCCTGATGCCATGATAGTTTTG ATGAATTTCCGTGAGGACGGTATGACACCATACTTCGTTTTCTTCAAGGATGGATTAACTCAGGAAAAATATTGAGGCGC TTCGTCTTCAGAATTTTGGGATTCATGAAACATCATCTTGTAATTTATAAATACAATGTGCTATTTTCTCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1879: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345014981281R95621SMNHADA008061SKSmAW
7824551713293AA143888MCCE0276.M1RSchistosoma mansoni, cercariae


Date: 22:10:23 on Fri 17 Nov 117.