CShisMan2_188


Sequence

>CShisMan2_188 (4 EST) Length=560 AAAGTTAACTTATTTTTTTTATAAAAAAAACTATAGTGTTTACATTTGTGTATTTTATTTCTTTGCTTGTTACTAAGTGC TATCTCCACNACACCCCCTTCCTGAAAAAAAAAAGAAAATCATATTTTGAAAGTAAACATTCATTGTACAAATACGTGAA TAACAATAATGTACGATCAAACTGAAGTGGAATTCCTTGTTAATTTAATTATTAGTACACAAAAATCAGAAAAATCATTT TCTCCTTATGAATATGACNATGATTTATTAAATACTACTTCACAATTTCCTACAGCATCTACAACACTCCCACCATCTGT ACCATCTATAAAATCATTTTTAAATTATCGTCCCCGTCAAAAAATTCTTATTTGTGGATTACCAGAATGATATATCCCCT TGTTTAGACTATGCAATGATAGCGAAAACCTGGGAATGATTGGACTACTCATCTCTAATTATTGCCAGTTACTGGATATT GAATGAATTAATTGTTAATTATTTTGGGAAAAATTAAAATTCATCTGGTCCATTGGGGATGAAACCCGACTATGAAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_188: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694603509861AI110891MF003D08.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696003510001AI111031MF001H05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696113510012AI111042MF001G04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696503510051AI111081MF001C06.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 21:23:57 on Fri 24 Nov 117.