CShisMan2_1881


Sequence

>CShisMan2_1881 (2 EST) Length=237 ATCAGTAAAGATGTGTTTATATGAAATTCAGAATAACTATTTTTTTTTTAAAAAAAAACTTCTACACCTTGAAAATTGTG AAAATACAGATACTTTTGGTTTGGAGTGAAGAAAGAAAAGAAAAGAAAACAGAAAGGAAACACAAGTTTAATGAATGTTT AATTGTTGCTAAGTTGATTGATAGTTTCTTTTTGGGAGGGGGTATCCACTCCTCTTGTACAAGCTTTCACACATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_1881: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39277514671T14504SMEST0165Schistosoma mansoni, adult worm, Gloria Franco
17370893190009AA999454MCCE3316.M1FSchistosoma mansoni, cercariae


Date: 17:53:34 on Fri 17 Nov 117.