CShisMan2_1889


Sequence

>CShisMan2_1889 (4 EST) Length=233 AATTCGGCACNAGGTCCANACCAAGCTTGCGAAGGGTGAAAGCGGTTGTTGGCAGAACTGGTTCTCAGGGTCAATGTACA CAGGTCCGTGTAGAGTTTCTGGATGATACTAATAGGTCAATCATAAGAAACGTGAAAGGTCCTATTCGTGAAGGCGATAT TTTAACCTTGTTGGAAACGGGAAAGAGAAGCCAGAAGATTACGTTAATGCATTCTAAATAAAAGGTGGTAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1889: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345021981288R95628SMNHADA019038SKSmAW
4179901125879N20707SMNHADA002023SKSmAW
12101892330478AA559782MC210261.NA3TBRI-Saber-cercaria-A
16891083116477AA952771SMTBADA000706SKSchistosoma Lambda Zap II


Date: 22:46:19 on Thu 23 Nov 117.