CShisMan2_19


Sequence

>CShisMan2_19 (12 EST) Length=739 TGGCCTGAAATTAACACTAATGGCATTGATATTGATAATAAAGATAATAACGTTATTAATAATCATGTTACTACAACATC ATTACCAAAACCAACTGAGAAAACCAAGTCTGAACACTTATTAGGTATAAAACCATGTACATGGGGACCATCTTATTGGT GTCAATCAGAAAAAATTGCCAAAAAATGCGGTAATGCAGCTTTAGAACATTGTAAAACCAAAGTATGGATTACTATGTCA AATTCAAAGAAATCATCACATAAGATAACTTCTAAACCTGATAATAAATGTACACGTGGTCCATCGTTTTGGTGTGCCTC ATTTGAAAATGCTAAATTATGCGGTGAGCATGCAGAATGGCATTGTCTGAATGTAGTTTGGTCAAATATACATAAATTCA AATCTGATTCTATCAATCCATAATTGAATAATGATCAATCTTAATTTTTACTGCTTAGAGGACATTTTTTTGTTTCCCCT TCTCATTTGAAACCTTTCTTTTATACTTCATCTTGCCTCTGTATTTGTGTTTGTGCCTATCCATCTATTGTTTGTTACTG TTTTTCCTACAAATTTGACTTTTTGAAAAACAATCCGAAATTATTGAGTATTTTTTATTTCTATCTGTTGAAAATAAAAT ATGAATAACATTTCGATTTTACACTGCTCAAAAGTCATTGACATTAATGTCTCATTTTTACTACATATACTATTTGATTA AAAGTTTACTGTTCAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_19: (12 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12165582338807AA566175MA3MARO7.AA3S. mansoni adult Lambda Zap
16629113080336AA931027SMTBADA000190SKSchistosoma Lambda Zap II
18155923385952AI067985EST209674Schistosoma mansoni, Phil LoVerde/Joe Merrick
18694173509818AI111130MF003H04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694593509860AI110890MF003D09.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694783509879AI110909MF003B12.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694843509885AI110915MF003B06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695083509909AI110939MF002H05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695133509914AI110944MF002G12.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695333509934AI110964MF002F05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696603510061AI111091MF001B07.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696623510063AI111093MF001B05.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 6:13:16 on Fri 24 Nov 117.