CShisMan2_190


Sequence

>CShisMan2_190 (2 EST) Length=563 TCACACCAACAGTGCGCGCGTCGTAAGCAAACGATTCACACATACCCACCAAAAAGGAAGGCACCTGCGGTTAAACAGAC ACTGAAGGCGGCCAGTATGCCCAGGTACAAATCACACTCATCAGCTGAATTCCCAGAGCTTGCAGGACAACTCCTGGAGC CCGTCTACCTATCGAGCGGAATTCACGCACTCTTTACTCTCTCTCCAAAGTACTTTTCAACTTTCCCTCACGGTACTTGT TTGCTATCGGACTCGTGTAAGTATTTAGCCTTGGATGGAGTTTACCACCCACTTTGGGCTGCATTCACAAACAACCCGAC TCCAAGGGTAGCTCAGAGCAAAACTGTCACACTTGATCTCTGCCCCCACGGGCCTTTCACCCTCTTTGGGCCAGAATGGG AAGCCGTACTCATTGCCTGGACTTGGGACAGAGCAGTAATGCCTGAAGCCACCCTAAACACCACATTGCCTTACGATCAA ATAACCGCAGGCTTCGGTGTTGGGCTAATCCCTGTTCACTCGCAGTTACTAGGGGAATCCTTGTTAGTTTCTTTTCCTCC GCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_190: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9263001929527AA285208MC1AO013.AEOS. mansoni cercarial Lambda gt11
9263031929530AA285211MC1AO016.AEOS. mansoni cercarial Lambda gt11


Date: 12:41:50 on Tue 21 Nov 117.