CShisMan2_192


Sequence

>CShisMan2_192 (5 EST) Length=624 GAATTCAAAGTAGGTGACTCAGTTTATGCACGGGATTTCCGGCCTGGCAAGCCAAAATGGATTTTTGGGTTTATAAAAAA ACGACGTGGTACAGTATTATATGAAGTGATGGTCGAAAATACACTAATTATTAGACATGTAAATCAACTGCGAGATAGAA AATGTGTTTATGAGTCATCTAAACTCAAACCATTACCAATGGAAGTATTATGTGATACGTTTGATATTCCACCACCACCA CCACAAGTTGAAATGAGAAAAAATGATCTAGAATCAGAAGTTAGACGAAGGTCATTCAGGAAACGGAAACAAACGAAATT TTTTCAAATAGACCCCAAAGTGAAATCATACGATCGAACTTCGCGAGGGAGGTGATGTGTGGGCGAGAATGATAATGATT GGTTGTCTTGATGAGTCAGACATTAGACAGGATGACAGGTGTTATGTATATATATATTTCCCTATCCTTATTATAGATTG ACACTTATTGAGACTTATTGACTGTTCCATGTGTCGGATTTTGGTGTGAAATATATTGACGTTATAGTCAGGCTAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAACATGCCATGCAGCTGCATTACCGTACTGCGTAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_192: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233992870801AA801593SMTBADA000913SKSchistosoma Lambda Zap II
18149643385324AI067357EST209035Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154543385814AI067847EST209531Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157393386099AI068132EST209822Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158253386185AI068218EST209909Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:19:46 on Sun 19 Nov 117.