CShisMan2_193


Sequence

>CShisMan2_193 (3 EST) Length=553 GTGCTTCTACCAGTTATACTGCTATTTCTTCGACTACTCCCACTGTTATCACTCCTCCTACCTCTTCTATTACCTCACTT GTTAAAAGCCTGTAGACAACACTAAAAAAAAACAACAAATAGCGCTCAAATGATATATATATGGTTTCGAATTGGAATTT CTTTTATTCTACGTCATTGTTCTAGTTTTACAGTCAAACTTTATAATTCATATTTCAACCGTATCATTCCAGAATATATA CGTGTGTATCTCCGATCCTTTTACTGTAACCTTACTGTTTGCAGAATCTACTGGCCACCTACAATATATTTATATATATA AAATATGTATGTATGCAAAAGGAATTTACTTGATGACAACATATGCTGTTTATAGCTCCCGTGTTCTTTCTGACCTTCAA TATACATATACTTTACTAATGTTCAAAACTTATCCTGTCCTGTTAAATAGTTTAATGTACTCTCATATTTATTTTCTTCT TTCTCGTTCGTTTCGTTTATGGGTACTTCGTACAGTATTATCATTTTATATATATATATATTATCACCATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_193: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150893385449AI067482EST209164Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152323385592AI067625EST209308Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153263385686AI067719EST209402Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:38:14 on Thu 23 Nov 117.