CShisMan2_1933


Sequence

>CShisMan2_1933 (3 EST) Length=385 AGGTTGGAAGTGTATTCATTAGAGGTAAACGTCTGCATATTTGTTTGATAAAACTATTTCTTTTCTATGGCTGGTTCAAA TGGAGGTGGTAATTTAATGGTTGATGGCTCAACACCCCATATATCTCGAGCATATTCACGTATAGTACGATCAGAAGAGA ATTTCCCAGAGGAAGCAATATTCATAAGCATCATTTTTGACCATCTTAGTTCATCTTTGTAAGCTTCCTCAACTTCTTGT TACACTCGTATATAACTTGCATAATCTGCACATAATAAGAAGCGATCATCGAATGCTAAACTATTATATATATCTTTAAA TAAATGTGGATTTTCTGGAGAGAAGAAGCCATCTCGAATTTGTTCCAGACACAATTTCTCGAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_1933: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679241366672W59934EST000455S. mansoni cDNA
9100521906117AA269085MA1MA020.AA3S. mansoni adult Lambda Zap
9102161906281AA269213MA1MR036.AA3S. mansoni adult Lambda Zap


Date: 19:26:33 on Sun 19 Nov 117.