CShisMan2_194


Sequence

>CShisMan2_194 (6 EST) Length=549 ACTAAATACGTTTCCCACTCTTTAAATATATAACATATATATAATAGATACAAAGAAACGAAATACAACGTGAGAAGAAA TATACAAATGAAGAAGAGTATTATGAAAAGCTAGTATTTTGATGCGCTCGAGTGCCACAGCATATATGGTATCAGTAAGC AGGGTGTAACAAACAAAGCGAAACCAATCCACTCAATTGTATGAGAAGTGAAACGCTTGTTATACTCCTTCAGTCTGTGA ATTGTAAGTAGACCAGGTGCAGAAGAATACAAAAAGGAACTTTTCTGCAAATCAGTAGACTTGTAAGTAATTGTAGCACT AGAAAAATTATGAACGCCATTTATTTGACGTTTGAGGATTATGACATGAGTGACGTTCGAGGAGGCAGGTACAACAGGCC ACCGAGCAGAAGGACTCCCATGAATCAATGTAAATTCTGTTTCGGAAAAGATATCAAATAGCTCAACATCTTTGGCAGCG CGTGACTCATGGAAATTATAAATTGTATATAGAAAAGTCATTTCTTTTTCCTGGAAGATAAACTCATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_194: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147143385074AI067107EST208777Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148513385211AI067244EST208918Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150013385361AI067394EST209075Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153833385743AI067776EST209460Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158803386240AI068273EST209964Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158813386241AI068274EST209965Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:8:40 on Sun 19 Nov 117.