CShisMan2_196


Sequence

>CShisMan2_196 (4 EST) Length=552 GCTTTTACCACTACTGCGTAAATAACAAGTGTTTGTCTTCAACAGACCCGCTGACTTTTGGATAACTGACTCTATTTGAT TGATAATTGACAGATGTATGTGACATTCAAGTCNATATTCAGTTGTTTGTGTTGCATGGTANATGGTTGTCTGTCGTCCC CTTTCTTCATCAAGATAATATGATTGTAGGCTTGAAGTACTAACAAATTATATAATTCCCATTAAAACTGAATTATCTGT GATTTAACTGGTTTCTTTCTGTTTAAAAACTATAATGTTATTATAATTATTATTATTATTATTATTACGTTAGTATTCAA CCACTAGTACCTTTTTCTCGTTGTACATTTATTATTTGCATATACATGATTTAATAACATCACAATAACCTATTCCTTTG TTTTTGTTTGTCGCTTGTGATTTGTGTTGTTTTCAGAAGGAATTAAACTATGTGGTCTTTCCNCATTTCTTTATTGATTT TCCCACTTTTAGCTTCTGGTATACATTCCCCCTCTTGGTCAATTTGGTTTTTGCTGAAATTCATTATCATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_196: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694743509875AI110905MF003C04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695123509913AI110943MF002H01.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695223509923AI110953MF002G04.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696533510054AI111084MF001C03.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 2:32:48 on Wed 22 Nov 117.