CShisMan2_197


Sequence

>CShisMan2_197 (3 EST) Length=705 GAATTCGGNGCNAGGTTATCTACCAACGGGAGTCGTATAAATACTTCAATGAAAACTATAGTGAATCCATATACTTGGTT TTCGAAGTGATTATTATTATTCTTAAACTTATATTATACCGNCATGCTTATTCAAATTGGATAATCCCTTGAATTCTGTN CTTCATGTTTTTTATTAATCTCTCTGTTTGAAACTCCTACTTTGGCCTTTTCTAATTGAATATTATTCCTTGGTTACGAT AATTCTTAGTTTAATAATTGGAATGAAAGAAATAACAGTTTCAGCCTTTTTCTGGCAACGGCACATGGCTTATTCCCAAG CATATATATATATATATATATATATATATATATATCAGCTACATAATTCCTTCAAAATTATTGAGNTAAAGAAANGCTAT TTAAGTAAATGCCAATTACATTTTCGTTTTCNATAATAATTAAGAACCAATCGAAACAGCTTTATTTCGTAGATAAGAAA AGGACCGTAATGAAAAAAAAGAGAACTTGAAATAAATAAGTTATGGCCTACAGTAGCTTTTATTTAACTCTTATATTGTT ATTATCATTTCTATTCTTGTTCTTATGTTTCCCAATTAATGATTACATAATAAATATAATCCATTCTAATAAAGCTGTTA CCATTTTATTTCGTTATGCTAATCACTTGAAGAAACAAAAAATAAATTAATTAGAATATCATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_197: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097352330024AA559819MU001003.NH3York-Harrop-lung-A
17369163189836AA999281MCCE3087.M1FSchistosoma mansoni, cercariae
17369423189862AA999307MCCE3121.M1FSchistosoma mansoni, cercariae


Date: 0:41:37 on Fri 24 Nov 117.