CShisMan2_198


Sequence

>CShisMan2_198 (29 EST) Length=789 AAACAGGAAACTAAGTTAATTTTAATAACAATTGCGAAAAAAACACCATAAAACAAATGACATCCTTGTAAAAAGGTGAC ACTAGTCCTTTACTATCAATATCTTAAATCTCGTTACACCGAGCTTTCTGTTGATAGTTTTAGAAGGGAGTTGCAGGCCT GTTCGATAAATATTTCGCCAAACGCGGTGAACTGGCTAACAGATTTTCTCGATGTTTATGGATCTCAGGATACTTGCCAG TTAGAAATCCTTTATCCAGATCAGTCACATGATCAATGACAGCAATCAGGACTAAATCAGCTAGAGTTACTTTGTCCCCA ACAGCCAGCTTTCCTGTCGACCCTTTCAGAGATTCGCAGATCATATTGAGAAGAACTGGAACTTTGCCGTTCAATATCTC TTTGGTTATCTTCTCTTTCTCTTCTTGTGGCTTCATCAAAGTTTTGTGATATTCATGTTCTACATCTTCAGCCTGACCAA TCAACTTTTCAACACTATAGTATTCCTCGTCTGTTTCACCCATCATATGATGTTTCTTCGCCATATACCGTGCAATAGCC AAACTCTCTAACATCCATTTCACGTGCCCATGATCATCAGTGACTTTCACTGCAGGCAATCGTCCGCCTGGAATAGTTGG TTTGATTTTTGGCCAATCTTGGAAACTAATTCTCTCATCTTCGTAGTCTACACCAGCTGCCACAAGAGTCATCCGAATCG ATTCAGNACGTCCGCGTCCGTNAAAATAGATAACCTTGATATGCTCGCCAGCCATCTTGCAAACGTNCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_198: (29 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39151514545T14378SMEST0039Schistosoma mansoni, adult worm, Gloria Franco
39152514546T14379SMEST0040Schistosoma mansoni, adult worm, Gloria Franco
39321514715T14548SMEST0209Schistosoma mansoni, adult worm, Gloria Franco
39322514716T14549SMEST0210Schistosoma mansoni, adult worm, Gloria Franco
39333514727T14560SMEST0221Schistosoma mansoni, adult worm, Gloria Franco
39372514766T14599SMEST0260Schistosoma mansoni, adult worm, Gloria Franco
60704529734T24131SMEST0329Schistosoma mansoni, adult worm, Gloria Franco
4236141139715N25367EST000471S. mansoni cDNA
5137181444971W06751SMEST0387Schistosoma mansoni, adult worm, Gloria Franco
9102601906724AA269257MA1MA067.ADIS. mansoni adult Lambda gt11
12098252330114AA559418MC250431.NA3TBRI-Saber-cercaria-A
17579913233170AI018834SMEST0472Schistosoma mansoni, adult worm, Gloria Franco
17579923233171AI018835SMEST0473Schistosoma mansoni, adult worm, Gloria Franco
17580323233211AI018875SMEST0514Schistosoma mansoni, adult worm, Gloria Franco
17580403233219AI018883SMEST0522Schistosoma mansoni, adult worm, Gloria Franco
17580453233224AI018888SMEST0527Schistosoma mansoni, adult worm, Gloria Franco
17580463233225AI018889SMEST0528Schistosoma mansoni, adult worm, Gloria Franco
17580513233230AI018894SMEST0533Schistosoma mansoni, adult worm, Gloria Franco
17580593233238AI018902SMEST0542Schistosoma mansoni, adult worm, Gloria Franco
17580623233241AI018905SMEST0545Schistosoma mansoni, adult worm, Gloria Franco
17580783233257AI018921SMEST0561Schistosoma mansoni, adult worm, Gloria Franco
17581433233322AI018986SMEST0626Schistosoma mansoni, adult worm, Gloria Franco
17581483233327AI018991SMEST0631Schistosoma mansoni, adult worm, Gloria Franco
17581493233328AI018992SMEST0632Schistosoma mansoni, adult worm, Gloria Franco
17581523233331AI018995SMEST0635Schistosoma mansoni, adult worm, Gloria Franco
17581613233340AI019004SMEST0644Schistosoma mansoni, adult worm, Gloria Franco
17581783233357AI019021SMEST0661Schistosoma mansoni, adult worm, Gloria Franco
17581823233361AI019025SMEST0665Schistosoma mansoni, adult worm, Gloria Franco
17581883233367AI019031SMEST0534Schistosoma mansoni, adult worm, Gloria Franco


Date: 18:31:45 on Sat 18 Nov 117.