CShisMan2_199


Sequence

>CShisMan2_199 (2 EST) Length=554 TTGTNGTGGAGNTACCTCGTACAGAGNATTATAGACAATATCAAATGAAGATACCACCGNCNTNGTAGGAGTTGGTGNAA TTGACCTATGCAACAGGTTGTNTTGAAGAAATAGCTGGTTTTGCACAACAATACTCAAATATATTAATAGGTCTATGTNT NCTCACAGCTATTCTTCAAGGTGTCTATTTAGGCATCTCAATTTGGATGATTCGCAAATCTGATGATGGAGTTGCTTTCT CTGCATAAACATTATATACCATTAAAGATCATGATCGTTATTATTATGGCAAAGGAAAGAAAAAAACTGACAAAAATACC ANTTNNTTTGGTTCTTTTCATTCCATTTTGGATTCTATCACTTTTGGGNTCTGGGCTAAACACATGAACTAATGTTACCC GACAATAACCATATAAGACGGNTATAAGCTTATTATTCAACTCATATCTTTGGACTATATCATGACTACATATTGAATGA GTCTCCAATGAATGCCATCCCATTAGTATTTCTAAGGTGGCGGAGGTGCCATGGTAATCAATGTATGGCATTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_199: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344847975903R95501EST000059S. mansoni cDNA
4192111128062N21929SMNHADA020028SKSmAW


Date: 9:2:42 on Sat 18 Nov 117.