CShisMan2_2


Sequence

>CShisMan2_2 (19 EST) Length=742 GAGTAGTATGGGGTCATCATATGTTTATGGATGGCTTTGGATTCGTTAACTGGAGTGTATTTTAGTTCTATTACTATGAT AATAGGTGTTCCTACAGGTATTAAGGTGTTTTCGTGACTTTATATGTTGAATAGTTGTGGTATGCGAGTTTTAGATCCCA TAGTATGGTGATTAGTCGGTTTTATATTTTTATTTACGGTTGGTGGTGTCACAGGGGTGGCTTTATCTGCATCTGCTTTA GATATACTGTTTCATGATACTTGGTTTGTTGTTGCTCATTTTCATTACGTTCTTTCTTTAGGTTCTTATAGAAGAATAGT GATAATGCTAGTATGGTGATGGCCGTTTATAGTTGGTTATAGTTTAAATAAGTATTTATTACAAGGTCACTGATTATTAT CTATGGTTGGTTTTAACTTGTGTTTTTTTCCTATGCATTATTTAGGTATACATGGTCTTCCTCGTCGTGTAAGTTGCTAT GATCAAGAATATTATTGGGTTAATGTTATAAGAAGAATTGGTGGAGTATTATCAGTTGTTAGAGGTTTTGTATTATTATT TATTTTGTGGGAGTCTTTGGTTGTTGGTAATCGTGTAATAGGATTATGAGGTTCAGGTGGGTGTGTTACGAAAGTGATGA CTGTTCCTGTTCCTAGTCATGTTGATTATTTAAATGCTTCTAAGTTGTGGGTGGCTAAGCAATCTTAGGTAATCATAGTA AATAGGTGGCTAAACAAGGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_2: (19 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39279514673T14506SMEST0167Schistosoma mansoni, adult worm, Gloria Franco
60721529751T24148SMEST0346Schistosoma mansoni, adult worm, Gloria Franco
344881975937R95567SMNHADA008011SKSmAW
344911975967R95597SMNHADA017014SKSmAW
7641501685466AA125714MLLG0137.M1FSchistosoma mansoni, lung stage
7791291702788AA140564MEEG0224.M1FSchistosoma mansoni, egg stage
17581093233288AI018952SMEST0592Schistosoma mansoni, adult worm, Gloria Franco
17654003241807AI026193MEEG0429.M1FSchistosoma mansoni, egg stage
17654193241826AI026212MEEG0448.M1FSchistosoma mansoni, egg stage
18145763384936AI066969EST208634Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146403385000AI067033EST208702Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147223385082AI067115EST208785Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147433385103AI067136EST208807Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147453385105AI067138EST208809Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149423385302AI067335EST209013Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151253385485AI067518EST209200Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153963385756AI067789EST209473Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158153386175AI068208EST209899Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159033386263AI068296EST209987Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:28:35 on Thu 23 Nov 117.