CShisMan2_200


Sequence

>CShisMan2_200 (7 EST) Length=550 GCACGAGGCAACTCAATCCGACGTAACATACTGCATGGTACACCTACCTTACGTTAATGGAATACTAAACCTCATGGGTC GTGGTACAACTGGTCAATCTAGTCCTGTGATTGAAGTTAAGCCGTCATTTTGTTGGGATTCAATGTTGGTACGACTAGCT GGATTGTCTGGGGCATTGGCTGTTATTGCGAGCGCTTATGGTGCCCATGGTTTCAGAGATGAACAAGATAAACAAAGACA AATTTTCAAAACTGGGGCTTATTATCATTTGGTTCATTCGGTGGCTTTGTTAACCACGCCTTTATTCAGACGTCCTGTTT TGTCTGCTACTCTTTTTGCCACCGGAACTCTACTGTTCTCTGGTTCATGCTATTATGTGGCTCTAACTGGAGATGATCGG TTTTCTAGAATAGCACCTATTGGTGGCATGACGCTCGTATTCGCCTGGCTTTCTTTGGTTTTCTAACAATTGCGCCAACT ATCTCGAGAGCTGTTTATTACTAATCATTCATTTTTCTACAAATTAATCGGCATATCGTAAACATGTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_200: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145793384939AI066972EST208637Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147523385112AI067145EST208816Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148033385163AI067196EST208870Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148503385210AI067243EST208917Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149743385334AI067367EST209046Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150263385386AI067419EST209101Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157613386121AI068154EST209845Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:51:35 on Thu 23 Nov 117.