CShisMan2_201


Sequence

>CShisMan2_201 (5 EST) Length=590 CAATCTTGACAAGTCTTGGCAAAGTTCAAAATCCCATGGCCTAATGTGGATGCACATAGTGGTGTATTACTCCAGCATTA TGGTCTTACTGAGATGCAGTATTATACAGTTCTATTTGGAGTTTCTCGAGCATTAGGTGTTTTAGCCTCTCTAATTTGGG ATAGAGCATTAGGCTTACCAATTGAACGACCTAAATCTTTATCTACTGAAGCATTAATGAAACTGGTGAATGATATTGGA CGTAAACAAGGTTAAATATAATTTATTCAACTCGGATCAAATATCTGTTCTAATTGGACATCTCTAGAAAAGTTATTTCT CCACTTTCAAACTTAAAAACAAATCATCTTAATAGCTAGTCGAAACTATTTTCTGTTTAATTCCCCATCCACGTCTTACT GCATAACACAATACATATGGTCATTGTTTCAAGTAGAACAGAACATTTTGAAAACTCATTCAAATGTTAATGTTTGGTTT GTTTTATGTATTTTTGGTATTCACCTTTTAATTATCTTTAGTATTCTTAAAATGATGTATATCCATGCCAAAAATATATA TATAAATCTAATAAAAAAGTTTTTTTCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_201: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12102012330490AA559794MC250456.NA3TBRI-Saber-cercaria-A
17369433189863AA999308MCCE3122.M1FSchistosoma mansoni, cercariae
17372393190159AA999604MCCE3569.M1FSchistosoma mansoni, cercariae
18155173385877AI067910EST209598Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159233386283AI068316EST210007Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:10:15 on Mon 20 Nov 117.