CShisMan2_202


Sequence

>CShisMan2_202 (4 EST) Length=547 AGTTGAAGAATTAGCTGTCTCTACAACCCCCATGACTGTTCGACGGCGAGCTATTTTCTTCTGTCTAACTACGTGACTTG TTACATTTAAAGGGTCTGTATTATTTGGCTTTTGTACGGCTGTATTATCTGATAAGATTTCAATGGAGTTTTTGCATGTC TTCTGGTTTCCAATTTTCTGTGAACTATTCACTCCGTAATTGTTTTCCATAAGACAGGTTCTAGTGGGTTGTGTATGCCT TCGGATAGATTTAGTTTGTTGTCGAGTTAGCGGTCTCCTAAGTGGTGTGGTAGAATTACGGTCAATGTTATTTAAGGGTA CAGATGATGAGGTATCACTAATGGCATTATTTACAACTGATATAATCAAATTACGCTGATGCTGATCAATATCAGAACTA CACGAAGTAGAAATTATTTGGTCATTTGTAAGTGCAGAATTAGCTAAATGATTAAATGTTGAGTGAAGTGTGTGAGGTAC AGTTTGAGCATTTGTTACTGGAACACAACCATCAACTTCATCAATGCCGCCACCACCAACGGGACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_202: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152983385658AI067691EST209374Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156113385971AI068004EST209693Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157473386107AI068140EST209830Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157843386144AI068177EST209868Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 7:20:45 on Mon 20 Nov 117.