CShisMan2_2032


Sequence

>CShisMan2_2032 (4 EST) Length=476 CCAAACTGGTGCTGTTAAGGTTCTTGTTGGGAAAAATTATAACGATGTGGTTAAAGACAAATCAAAAGACGTGTTTGTCA AACTGTATGCTCCTTGGTGTGGTCATTGCAAGGCTCTTGCTCCAGTTTGGGATGAATTGGGTGAGACTTTCAAGAACTCA GATACGGTGCATCGCAAAAATGGATGCTACGGTTAATGAAGTTGAAGATCTTAAAGTTACCAGTTTTCCAACTCTCAGGT TTTATCCAAAGAACTCGGAGGAGGTTATTGATTATACAGGTGATAGATCATTTGAANCCCTGAAAAAGAACGTCGAATCT TGGTGGTAAATCCAGTGAAGCAACTAAACAAGAAGATCGAAATAAAGGATGAACTTTAAAGAAGCTTCCTAAAAAGGCTT TATTTTGCTTTTGGGCTCGTATCTCTCTTGCTCTGAAGACTGTTGTCATTCTAATCAATAAACAAGCGATAGTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2032: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100431906108AA269076MA1MA011.AA3S. mansoni adult Lambda Zap
9102541906718AA269251MA1NE006.AASS. mansoni adult Lambda Zap
11587042252881AA514116MA2AS022.AASS. mansoni adult Lambda Zap
12165782338827AA566195MA3MR063.AA3S. mansoni adult Lambda Zap


Date: 21:55:30 on Fri 17 Nov 117.