CShisMan2_2035


Sequence

>CShisMan2_2035 (2 EST) Length=259 CTTCTGTAGATTCATGAGTTAAAGCATAACTAATTGTNATTTTAGACGATTTTAATTTATTTATATTATTATAATTATTC AATTTCATGATTATTATTATTATTATGTGTAGTATTCATATCAGTATTATGTAATTGATTTGGTGATTTTGTACCACCAA TCTTCTTTATTATAATTATATGAAGTAGGAACGGTACCATTTTGAAGTTTACTATTATTATTATTGATTTGATCCACTTG ATGTAGATCATGTTTCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2035: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100331906098AA269066MA1MA001.AA3S. mansoni adult Lambda Zap
11587382252915AA514059MA2MA123.AA3S. mansoni adult Lambda Zap


Date: 17:51:17 on Mon 20 Nov 117.