CShisMan2_204


Sequence

>CShisMan2_204 (7 EST) Length=550 GTTTTGAACAAGGTAGCTATGTTTGAAAGGCAATGAGTAGTATTGGTAATAATAACATTAGTATACTAACAATATACACA CACACAGATGAGGGAAACAAAGCGAAAACAAAACAAGAAAGAAGAAATAAACTAGAGTAACGGAAGCAACNAAAAAATAA ACAAGAATAAAGTTAAAAAAACAAAAAAATAAGTAATCTGGTGATAAATTACTTAACAAAAAAATATGATAACGATAATA ATAATAATAATAATAATAATCTGTGAAACGTACACAAACACACATACATACAAACTGTGAAATTATTCGCAATACAGACA TGATGAAGTCAAAAAGAAAGGGGAAGAAAAGGGTACAAGAACTGTATATGAGATGATTAAACAATGAACATGGATGTTGG TGTACTTGTTGTGTATGGTATGTACATTAATCGAATTTACTAAGTGATAAGGAGAATAGACAATCCAATGGATGATGAAG CGTAAATAAGAGTTGTATGATTATTTGATGTGAAGAAGAAAGAGAATAAAAAAGACAACATTGGATATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_204: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694123509813AI111125MF003H09.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694453509846AI111158MF003E11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695153509916AI110946MF002G10.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695233509924AI110954MF002G03.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695253509926AI110956MF002G01.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695303509931AI110961MF002F08.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696473510048AI111078MF001C09.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 22:25:40 on Thu 23 Nov 117.