CShisMan2_2049


Sequence

>CShisMan2_2049 (2 EST) Length=323 TTAGGAACACCAGGGAATTGGGAGCATATCATTAATCAAGTTGGCATGTTCTCATATACCGGCCTAACACCTACTCAAAC ACAATATATGAAGACAAAACATCATTTATACATTATGCATGATGGTCGAGATTAATATGTCGCGTTTAACTTACAAACAA TATTGAGCAGATCGCACAAGCTATACACGATACGGTCATTAATGAATTAAAGAATAATCACTGGAAAATTTATGGGATAA AAATTTTTGTTTAGGTTAAATAAAGAAGTCGATCAAGATATATGTTTGTTATTTTCTCTTTGATGTAGTTAGTTCAGTTT TTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2049: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236291139730N25382EST000532S. mansoni cDNA
4291811145907N28051EST000289S. mansoni cDNA


Date: 22:3:13 on Fri 17 Nov 117.