CShisMan2_2053


Sequence

>CShisMan2_2053 (2 EST) Length=253 CGTGATGTGATGTCTTTTCGCCAAGATACTGTCTTTAGCTCATTCTCTTTTAATCTAATAAAAGAAAACTGGTCTAAATC AACGTCAGTTTGAATGGATACATCTTTTACTATTACGGCTTACGGGAACAGGTTCAGGTTACGGTTCCGGTTCCGGTTCC GATGAAATCAATTCAACAAACATAAAACAATACAAGTATCTTCCAAATCATGAACACTAGAATGATATTCCTTAATTGAA NCTCTTTANCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2053: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179671125856N20684SMNHADA001009SKSmAW
9102461906710AA269243MA1AS012.AASS. mansoni adult Lambda Zap


Date: 11:13:21 on Sun 19 Nov 117.