CShisMan2_2068


Sequence

>CShisMan2_2068 (3 EST) Length=207 CCGAACGACCAGTTGTGACCAGTGAGGATCACAGAGAGTTGAAGACAGTGAAACCTGATCATATGATGTCAGTGAGTGCC TCCTACGCAGAGTCGCCTGTCCAACAGCCACCACCTCGTCATCTGACTGAGACTGCCACACAGGCGACCTCCGTCACCAC ACACATCGTGGAATCCAGTCAGCATGAGATTGTCTCGAAACGCACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_2068: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11826502160107L81244SCMRAP0364C2/S1 day seven schistosomula mini-library
11826532160110L81247SCMRAP0367C2/S1 day seven schistosomula mini-library
11826572160114L81251SCMRAP0371C2/S1 day seven schistosomula mini-library


Date: 13:8:55 on Sun 19 Nov 117.