CShisMan2_2072


Sequence

>CShisMan2_2072 (2 EST) Length=206 AAATTTAGGTAGCGTAGTATTTAATCAAAGTAATTTCGGGTTTTGCCAAACCAAAAACTACCTACTACATAATTATCGAT TAAAAAAGTGTCAATATTGATTCAATAAATTAAAACAAAAGTAAATTTCCTTTAAACCTAGTGACATAAATGTTATCTTC AAAATTCCATCATTCTCTTCAGTACTTTCTTTTCTTTCCTAAATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2072: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644441017371H63025EST000275S. mansoni cDNA
16716363098723AA938824SMTBADA000275SKSchistosoma Lambda Zap II


Date: 14:0:29 on Mon 20 Nov 117.