CShisMan2_2077


Sequence

>CShisMan2_2077 (6 EST) Length=628 CGAAGCCTTTAGGTGGTTTATTACATAAGAAAAAATAAACACAAAAATATGCACTCAATCAACAGCTTTATTCTATATTA AATTTTAGTTATATTACTCATTTTCTGTGTGTTCTATCTGTTTTTTTTCGGAATATTCATAGTTTCCTTCTTCAGATATA CTAGTCACATTCTAATGACTGCTACATTTAAACCTAATCCCCAAACGTTACCCCCTAAAAGCTATATATTTATATATGGC TTACAGACATGGGTTATGAAAATGGCNTCTCTCAGTTATAATATTTATGATATTTTGTCCTATTCGTTTTTTCCCATTAT TTGTTTATATTTGTGTGTTAGTTTATTATATTACCATATTTGATGTAATTGTAATATGTTTACTGGTTAGTAGTATATTT TTAATAATTTGTTCGGATTGCTNTCTAATACATATATATTTATTCTATGGATTNTCATATTTCCATTTGTATCTATATGC AGTTGGAATATATGTTAATTAGTCTCTTTTATTTTCATGTGTTCTTGTTGTATCCACTGATATTTGTTTAATTTAGTGCT CTTCTGTTGTNGGGTTTTACTATCTTCACTTTTAAGACAGTTTGCTCAAATTATACAATATTTAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_2077: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11529122245747AA508307MAAD0450.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
17369043189824AA999269MCCE3070.M1FSchistosoma mansoni, cercariae
17369053189825AA999270MCCE3071.M1FSchistosoma mansoni, cercariae
17370203189940AA999385MCCE3229.M1FSchistosoma mansoni, cercariae
17370783189998AA999443MCCE3300.M1FSchistosoma mansoni, cercariae
17372893190209AA999654MCCE0113.M1FSchistosoma mansoni, cercariae


Date: 14:41:23 on Sun 19 Nov 117.