CShisMan2_208


Sequence

>CShisMan2_208 (20 EST) Length=832 GCACGAGAGACAACTCAGGAAACAACCAAGATGGTCCTCCGTCGAAATTCCAGCGTTCTTCCGTTGATCTAACCAATGTT TCCATCAGATTTCTTATTCCTGGGAGGGCTGCAGGGATAATGATTGGGAAGGGTGGGGAAAATATCAAAAAAATACGGTC ACAGTATAACGTCAAGCTGAATATTCCCGACAGCAGAGGCCCTGAACGGATAATGACTATCGAAGGTGACCTGCAGGCCA TCTGCAGCATCATGCGCGATGTTTGCCCGAAGCTGAAGGATATAATGAATGCCAAACTTTCCGATCCGAAACGCATAATG GGTACCCAAGGATCTCGACGCCGCCCAAGACGAAGTGAAGACCCAGAACGAGATGATGAGGAAGACGAAAACATGATTGA CTTCAGAATCTTAGTGCACGAAAGCCAAGCTGGGTCTGTAATCGGTCGAGGCGGTGAACGTATTAAGGACCTTCGTGATA AGTACAAGATGCGTGTTATCAAGGTGTATCAGATGTTGGCTCCATTATCTACTGATCGAGTTGTACAGATGGTCGCTGAC CCAGACAATGTCGTCCAATGTTTGAGAGCTGTGATAGAAGCAGTGGAGTCTGCTCCTCCTCGTGGTCGCCGTGAAGATTA TAACGCTGCCAACTTCAGTAAGGGTGATGCCCTCAACTATGGCGGTTGGCTGTNTCGAGAAGCTGCAGCAGCACTAGCTC AAGGNATGCCCCTCCNTGGGCCTGGGTGCATGCCACCNATGGGTTATAATATGGGAGGTCCGTATATAATGGGTNGTTGG TGACATGGGGCCCAATGGGCGGNGGGCATGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_208: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39184514578T14411SMEST0072Schistosoma mansoni, adult worm, Gloria Franco
39235514629T14462SMEST0123Schistosoma mansoni, adult worm, Gloria Franco
18145923384952AI066985EST208650Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146013384961AI066994EST208660Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146023384962AI066995EST208661Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146193384979AI067012EST208679Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149753385335AI067368EST209047Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149763385336AI067369EST209048Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150353385395AI067428EST209110Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151163385476AI067509EST209191Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153063385666AI067699EST209382Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153753385735AI067768EST209452Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154433385803AI067836EST209520Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155103385870AI067903EST209591Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155313385891AI067924EST209612Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157123386072AI068105EST209795Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157713386131AI068164EST209855Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158233386183AI068216EST209907Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158343386194AI068227EST209918Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158673386227AI068260EST209951Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:6:4 on Tue 21 Nov 117.