CShisMan2_2084


Sequence

>CShisMan2_2084 (2 EST) Length=327 TCACGAAAGTTCCCATTTTTAGATTTATGAATAATAACTNTCATTCACACGAGTTAGTTCTGGATGTTTTTCGTTGAACA TTCAAGGCAATTCATTCATGTTTGCTGTTTAACAAGTCTCGTTTTGGTGTGTTAAATACTTTTCAAATTATATCAACATC TGCATTTTTCTTTGTGAATGTAATTAAAATGTCTGATTGGCCCTTAGCTGTAGTCTTAATTTTTCGGGATATCTCTAACA TTTTATTGAACTGCCTTGATGAGCATAAGATGTACAAACTCTGTAGCACAAATATATTGAAAGTATCTTAAAACAATTTG TTATAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2084: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17370983190018AA999463MCCE3327.M1FSchistosoma mansoni, cercariae
17372443190164AA999609MCCE3580.M1FSchistosoma mansoni, cercariae


Date: 23:25:40 on Sun 19 Nov 117.