CShisMan2_2095


Sequence

>CShisMan2_2095 (3 EST) Length=198 CCTGCAAGACATGGCTGACATTGNCCACTAATATGTATTAACACAGTAAAGTTTCACACATGGGAAATACAGTCTGGAAC ATCTGTCCTACTGTGNGCACATTCTCCTGGATACAACATTGAAATAACTAAAAGTGACAATCATTACATTAATATTGCAT AATAAAATTGATTCATGAGCATGGTTACAAAAATGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2095: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364721644608AA098638SMTBADAMS0642SKS. mansoni cDNA
8577901832550AA218457MAAD0114.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
16890973116466AA952760SMTBADA000642SKSchistosoma Lambda Zap II


Date: 8:20:0 on Thu 23 Nov 117.