CShisMan2_2096


Sequence

>CShisMan2_2096 (2 EST) Length=274 TTATTTTACTATGTAAAACGGAAATTTTTTGCTTATCATATCATTTTTCTGCGAATGTATGAAAGAGATATGCATAGACT CTAGTTGTTTTTTCCAAAATGGATTGGTAATTAATACACGAAAGATGGGGGTGACCATGTGCATTATCACTGCTAAGGAC TATACCGAGCATTCTTGTCATCGACCACAGACAACGAAGCATTAATAATGTTCATTTGGTTAATCTATCCATAATGCTTA ATTTCAATTAATAAACATTTTTTTAAAAGATTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2096: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190311126918N21748SMNHADA017035SKSmAW
15233912870793AA801621SMTBADA000861SKSchistosoma Lambda Zap II


Date: 19:54:17 on Fri 17 Nov 117.