CShisMan2_21


Sequence

>CShisMan2_21 (2 EST) Length=672 GGTTTTACTCTTGTGATTTGTTGCATGATGACTAATCTATTAACTTCTGGTCATAGACGTTATAACCCACTATTAGATGA GTGGATTATTGTTTCTCCACATCGAATTCAACGTCCTTGGGAAGGACAAATTGAATCCGATGATCGTAAACTCACAGAAG TAACTGACGTTTCTGTAAAATGCACCAAAAATCCATTGTCACCCGAGTCCGTTCGTGCAAGTGGCTTGATCACACCCAAC TATCAATCTGTTTACACATTTCACAATGACTTTCCTGCTTTGGTTAATGTAAATGGTGATTGTGAAAGTGTTAGTTTAAC GAGCTTCAGGTCTGTTGAAGAAAATCCATTATTTGCATGTGCGCCTGCACAAGGTGACTGTTTAGTTACTTGTTTTCATC CAGATTCTAACAAAACCTTAGCGCTGATGGAACAGCGTGAAATACTACCAGTTATTAATGAATGGTGCCGTATTACTGAG AAATATTTCAAAATGAAGAACTTTCAGTGGTTGCAAATTTTTGAGAATCGAGGTGCAGCTGTTGGTTCGTCTAACACACA TCCTCATGGCCAAGTAAATTATGACACCCAAATGCTTTTCCATTTAAATTTTATCTTGCTTTGCTATCTCATGTTTTTCG CCTCTGACATTTACTTAAAGATAATTATATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_21: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152103385570AI067603EST209285Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157973386157AI068190EST209881Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:42:26 on Fri 17 Nov 117.